LCPDb-ARG (Antibiotic Resistance Genes) is a subset of LCPDb - here we present primers extracted from published papers and analysed by our pipeline.
Original article available here
Ranking of available primer pair(s) :
# | Specificity | Efficacy | Taxonomy Efficacy |
---|---|---|---|
1 | 0.98 | 0.54 | 0.7 |
2 | 0.1 | 0.13 | 0.57 |
3 | 0.06 | 0.12 | 0.3 |
4 | 0 | 0.13 | 0.57 |
5 | 0 | 0 | 0 |
6 | 0 | 0 | 0 |
7 | 0 | 0 | 0 |
8 | 0 | 0 | 0 |
9 | 0 | 0 | 0 |
10 | 0 | 0 | 0 |
11 | 0 | 0 | 0 |
12 | 0 | 0 | 0 |
13 | 0 | 0 | 0 |
WPS = Wrong Product Size
BOtG = Binds Outside the Gene
This heatmap shows if given primer pair (#) amplifies investigated gene variants from the pool of taxa in which all variants of particular gene were identified. (green = amplification, red = no amplification)
471 bp
dfrA_F_(5)-461
AAAATTTCATTGATTTCTGCA
Primer Length | Primer GC% | Primer Melting Temp. |
---|---|---|
21 bp | 24.00% | 42.64°C |
dfrA_R_(5)-461
TTAGCCTTTTTTCCAAATCT
Primer Length | Primer GC% | Primer Melting Temp. |
---|---|---|
20 bp | 30.00% | 43.58°C |