LCPDb-ARG (Antibiotic Resistance Genes) is a subset of LCPDb - here we present primers extracted from published papers and analysed by our pipeline.
Original article available here
Ranking of available primer pair(s) :
| # | Specificity | Efficacy | Taxonomy Efficacy |
|---|---|---|---|
| 1 | 1 | 1 | 1 |
WPS = Wrong Product Size
BOtG = Binds Outside the Gene
This heatmap shows if given primer pair (#) amplifies investigated gene variants from the pool of taxa in which all variants of particular gene were identified. (green = amplification, red = no amplification)
239 bp
erm33_F_(1)-332
TCTGCAACGAGCTTTGGGTT
| Primer Length | Primer GC% | Primer Melting Temp. |
|---|---|---|
| 20 bp | 50.00% | 51.78°C |
erm33_R_(1)-332
TCAAAGCCTGTCGGAATTGGT
| Primer Length | Primer GC% | Primer Melting Temp. |
|---|---|---|
| 21 bp | 48.00% | 52.4°C |