Antibiotic Resistance Gene Primers


LCPDb-ARG (Antibiotic Resistance Genes) is a subset of LCPDb - here we present primers extracted from published papers and analysed by our pipeline.
Original article available here

Browse by antibiotic class
Browse all genes
Browse all primer pairs

Primers amplifying vatB gene


Ranking of available primer pair(s) :

#SpecificityEfficacyTaxonomy Efficacy
10.6711

WPS = Wrong Product Size

BOtG = Binds Outside the Gene

This heatmap shows if given primer pair (#) amplifies investigated gene variants from the pool of taxa in which all variants of particular gene were identified. (green = amplification, red = no amplification)

#1
Staphylococcus
Product Length:

136 bp


Forward Primer Name:

vatB_F_(1)-363


Forward Primer Sequence (5' - 3'):

GCTGCGAATTCAGTTGTTACA


Primer LengthPrimer GC%Primer Melting Temp.
21 bp43.00%50.45°C
Reverse Primer Name:

vatB_R_(1)-363


Reverse Primer Sequence (5' - 3'):

CTGACCAATCCCACCATTTTA


Primer LengthPrimer GC%Primer Melting Temp.
21 bp43.00%50.45°C
Specificity 67.00%

Efficacy 100.00%
Reference (primer origin)

Safarpoor Dehkordi, Farhad et al. “Phenotypic and genotypic characterization of antibiotic resistance of methicillin-resistant Staphylococcus aureus isolated from hospital food.” Antimicrobial resistance and infection control vol. 6 104. 4 Oct. 2017, doi:10.1186/s13756-017-0257-1